I obtained TE sequences from TAIR at ftp://ftp.arabidopsis.org/
If you search the TE AT5TE28285, you will get this one:
>AT5TE28285|-|7818034|7819050|SIMPLEGUY1|DNA/Harbinger|54 bp AATTATTGTAATGTATTTTCAAATTTGACA ATGAATTTAGAAGAAACACGAGAT
The first line (FASTA header line) says this TE is at 7918034bp-7819050bp on the reverse strand (of chromosome 5), and the length is 54 bps. And the sequence below is really 54 bp.
However, 7819050 - 7918034 +1 = 1017 which is not 54.
I tried to confirm the coordinates using another sheet at TAIR: ftp://ftp.arabidopsis.org/
Over there, the coordinate of this TE AT5TE28285 is also from 7918034bp to 7819050bp.
I tried to find more information from arabidopsis.org. On GBrowser, it gives me the result consistent with coordinate http://www.arabidopsis.org/servlets/TairObject?type=sequence&id=2503988071 while on sequence details page, it says the TE is 54bp http://www.arabidopsis.org/servlets/TairObject?type=sequence&id=2503988071 .
I hope I am not drunk due to intensive study on the crazy post-storm NYC transit schedule.
Anyone has any idea?
PS: I decide to write a program to verify the coordinates and sequence lengths of all sequences now.
No comments:
Post a Comment
Your comments will wait for my moderation. Sorry about this inconvenience. But I have to do so to stop spam comments.